Calorie restriction has no effect on bone marrow tumour burden in a Vk*MYC transplant model of multiple myeloma

0
7

animal ethics

This study was approved by the South Australian Health and Medical Research Institute (SAHMRI) Animal Ethics Committee (ethics approval number: SAM21-016). Male C57BL/6J mice were bred and housed in pathogen free conditions at the SAHMRI Bioresources facility (SAHMRI, Adelaide, Australia). All experiments were performed in accordance to the Australian code for the care and use of animals for scientific purposes. Where applicable data and methods were described in line with the ARRIVE guidelines.

Dietary regimes

From 4 weeks of age group-housed male C57BL/6J mice were randomly assigned either a high fat diet (HFD) (specialty feeds, Australia, SF16-096; 43% kcal fat), or normal chow diet (NCD) (specialty feeds , Australia, SF09-091, 23% kcal fat). At 9 weeks of age all C57BL/6J mice were transferred from group housing to single housing in fresh cages. From 9–10 weeks of age ad libitum food consumption of NCD mice was measured daily at 9:00 am. Mean food intake was calculated over the final 3 days to allow mice to adapt to the stress of single housing before assessing food consumption. From 10 weeks of age NCD mice were assigned to either remain ad libitum on a NCD or changed to a CR diet. Dietary assignment was based on groups with equal means and standard deviations for starting weights. Mice assigned to a CR diet received 70% mass of calculated normal chow ad libitum intake, equating to 2.4 g/day. The diet of CR mice was changed to specialty feeds SF21-016, a micronutrient enriched diet to prevent potential micronutrient deficiencies. The CR diet was administered once daily by placing patty pans of pre-weighed food directly into cages at 9:00 a.m. Mice were maintained on their assigned diet until human endpoint at either 16 weeks of age (Pre-tumour Endpoint) or 25 weeks of age (Tumour Endpoint) (Fig. 1a). Comparison of nutritional parameters and dietary composition are shown in Supp Table 1.

Glucose tolerance test

The morning of the glucose tolerance test (GTT), CR mice were provided a normal daily food portion at 6 am (2.4 g, SF21-016), while NCD and HFD mice remained ad libitum. At 8 am all mice were moved to new clean cages with food removed to begin a 6-h fast equivalent for all diet groups (08:00–14:00). At 2 pm fasting blood glucose levels were measured using a handheld glucometer (Accu-check, Roche, Australia). Mice were then administered 2 g/kg glucose by intraperitoneal injection with blood glucose readings taken at 15, 30, 60 and 120 min post injection. At fasting (0 min) and 30 min timepoints, whole blood samples were collected. Serum was isolated by centrifugation at 3000×g for 10 min and immediately frozen at − 80 °C for later assessment of insulin levels using a commercial insulin ELISA kit (EZRMI-13K, Millipore, MA, USA) as per manufacturer’s instructions. The GTT was performed 4 days prior to the pre-tumour endpoint to allow recovery of the mice prior to humane killing.

Body composition

Body was measured at 16 weeks of age by EchoMRI body composition analyser (EchoMRI LLC, Houston, TX, USA) as per manufacturer’s instructions.

humane killing

At 5 pm on the day prior to termination mice were transferred to clean cages and provided with half their daily food intake to ensure equivalent fasting between diet groups. CR mice were provided with 1.2 g SF21-016, NCD mice were provided 1.7 g SF09-091, HFD mice were provided 1.7 g SF16-096. This approach was done to ensure any differences between groups reflect effects of longer-term CR, and not simply differences between fasted (CR) and non-fasted ad libitum mice. On the day of humane killing mice were anesthetized by isoflurane inhalation and cardiac bled using a 26G needle followed by cervical dislocation.

ELISA

Fasted blood samples were collected at the end of the study via cardiac puncture into Minicollect serum gel tubes (Cat# 450533, Greiner vacuette, Kremsmünster, Austria). Sera was isolated by centrifugation at 3000×g for 10 min at room temperature and stored in aliquots at − 80 °C. Commercial ELISA kits were used for the measurement of: leptin, adiponectin (EZML-82K and EZMADP respectively, Millipore, Burlington, MA, USA), and IGF-1 (MG100, R&DSystems, Minneapolis, USA) as per manufacturer’s instructions.

Bone parameters

Bone isolation

Tibias were dissected from mice using scissors, razor blades and gauze to limit contamination by extraosseous tissue. Bones were fixed in 10% neutral buffered formalin (Ajax Fine Chem, NSW, Australia, cat#2518) for 24 h at 4 °C on a rocker then transferred to PBS at 4 °C.

Calcified bone μCT scanning

X-ray micro-computed tomography (μCT) was performed using a SkyScan 1276 (Bruker, Kontich, Belgium). Tibias were scanned at 60 kV/200 mA using a 0.25-mm aluminum filter, a 0.2 rotation step, and two-frame averaging with an isometric resolution of 5 μm/pixel. Images were reconstructed using NRecon software (Bruker) with a ring artefact reduction of 8, beam-hardening correction of 30%, and smoothing of 1.

Decalcification

Tibias were decalcified in a solution of 14% EDTA (E1644, Sigma-Aldrich, Burlington, MA, USA) pH 7.4 at 4 °C, with the EDTA solution replaced every 2–3 days. After approximately 2 weeks, decalcification was confirmed by X-ray imaging. Following this, bones were washed with PBS 3 times to ensure complete removal of the EDTA solution.

Osmium tetroxide staining

Tibias were stained with 1% osmium tetroxide solution [equal parts 2% osmium tetroxide (Electron Microscopy Sciences, Hatfield, PA, USA, cat#19192) and 0.1 M Sorensen’s buffer (19 mM KH2PO4, 81 mM Na2HPO4, pH 7.4)] as previously described62,63. The solution was left on the bones for 48 h then removed to a waste container containing oil for sufficient neutralisation. Bones were washed for a minimum of 72 h with buffer changed 2 x per day. All wash solutions were placed in waste container for decontamination.

Osmium tetroxide stained bone μCT scanning

Osmium tetroxide stained bones were scanned in a SkyScan 1276 (Bruker). Bones were scanned at 90 kV/200 mA using a 0.5-mm aluminum filter, a 0.2 rotation step, and two-frame averaging with an isometric resolution of 3 μm/pixel. Images were reconstructed using NRecon software (Bruker) with a ring artefact reduction of 8, beam-hardening correction of 30%, and smoothing of 1.

CTAn analysis

Analysis of the bone microarchitecture was performed using CTAn (Bruker). Trabecular and cortical regions of interest (ROI) were selected for analysis of calcified tibias. For analysis of proximal and midshaft regions, areas of 400 microtomographic slices were selected 60 and 1200 slices distal to the growth plate respectively. For osmium tetroxide stained samples, BMAT quantification was performed on whole bone, as well as proximal and distal regions with the boundary defined by the tibia-fibula junction. In all cases, regions of interest (ROI) were manually drawn and analysed in CTAn using adaptive thresholding.

Vk*MYC model of MM

At 16 weeks of age C57BL/6J mice were inoculated with Vk14451-GFP whole BM suspensions kindly provided by Dr Michelle McDonald (Garvan Institute, NSW, Australia). Cell stocks were expanded by serial passage in vivo through BM. P3 cell stocks were thawed into RPMI-1640 containing 10% fetal calf serum (FCS) and later resuspended in sterile phosphate buffered saline (PBS) equivalent to 2.5 x 105 GFP+ tumour cells/mL calculated based on the percentage of GFP+ cells by flow cytometry. Mice were injected intravenously with 100 µL of cell suspension equating to 25,000 MM PCs. MM tumour was allowed to develop until endpoint was reached. Tumor burden was monitored weekly by serum protein electrophoresis (SPEP) on a Sebia Hydragel b1/b2 kit (Sebia, Norcross, GA, USA) as previously described64. Hind limbs (femurs/tibias) and spleens were dissected at endpoint for subsequent flow cytometric or morphological analysis. Two mice with missed intravenous injections were excluded from analysis.

Flow cytometry

For analysis of MM PC within the BM, femurs and tibias were crushed in PFE buffer [PBS, 2% FCS, 2 mM ethylenediamine tetra acetic acid (EDTA)] using a mortar and pestle. The resulting BM cell suspension was homogenised and passed through a 70 μm filter. For analysis of MM PC within the spleen, spleens were excised, cleaned of connective tissue and homogenised between two frosted histology slides. Splenocytes were washed with PFE, filtered, and subjected to 1 × round of red blood cell (RBC) lysis. Splen and BM samples were resuspended in PFE and immediately run on the BD LSRFortessa™ X20 with subsequent analysis performed using FlowJo v10.0.8 software. In all instances, a BM from a naïve (non-injected) mouse was used as a negative control for gating.

qPCR

Total RNA was extracted from BM cells and splenocytes using TRIzol reagent (Invitrogen, MA, USA) and isopropanol precipitation according to manufacturer’s recommendations. cDNA was synthesised from 1.5 μg total RNA using Superscript™ IV reverse transcriptase (Invitrogen) as per manufacturer’s protocol. qPCR was performed on the Quantstudio 3 Real-Time PCR System (Applied Biosystems, MA, USA) using RT2 SYBR® Green reagent (QIAGEN, Hilden, Germany). Gene expression was analyzed using the ΔCt method (2−ΔCt) normalized to RLP0. RLP0 normalisation was chosen based on its known stability as a reference gene in HFD-fed C57BL/6J mice65and its stability as a housekeeping gene in BM66. The following primers were used: RLP0 F: 5′ AGATTCGGGATATGCTGTTGGC 3′, RLP0 R: 5′ TCGGGTCCTAGACCAGTGTTC 3′, TNFα F: 5′ CCTGTAGCCCACGTCGTAG 3′, TNFα R: 5′ GGGAGTAGACAAGGTACAACCC 3′, IL1β F: 5′ GCCACCTTTTTGACAGTGATGAG 3′, IL1β R: 5′ AGCTTCTCCACAGCCACAAT 3′, IL6 F: 5′ TAGTCCTTCCTACCCCAATTTCC 3′, IL6 R: 5′ TTGGTCCTTAGCCACTCCTTC 3′, MPO F: 5′ TCCCACTCAGCAAGGTCTT 3′, MPO R: 5′ TAAGAGCAGGCAAATCCAG 3′, human MYC F: 5′ CGTCCTCGGATTCTCTGCTC 3′, human MYC R: 5′ GCTGCGTAGTTGTGCTGATG 3′.

Morphological analysis

Splenens were excised from tumour-bearing C57BL/6J mice at experimental endpoint and visually inspected for the presence of extramedullary tumour lesions. Splines were photographed by a ruler for a later assessment of spleen length to the closest millimetre by ImageJ analysis software.

Peripheral blood counts

Whole blood samples were collected from mice by terminal cardiac bleed into Minicollect K3 EDTA tubes (Cat# 450531, Greiner vacuette, Kremsmünster, Austria). Complete blood counts were performed using a HEMAVET950 automated blood analyser (Drew Scientific, FL, USA), according to the manufacturer’s instructions.

Statistical analysis

All statistical analyzes were performed using GraphPad PRISM (version 9.00; GraphPad Software, La Jola, CA, USA). Groups were compared using one-way or two-way analysis of variance (ANOVA) with Tukey’s or Sidak’s multiple comparisons post-tests, as indicated. Correlation was assessed using Pearson’s correlation coefficient.

LEAVE A REPLY

Please enter your comment!
Please enter your name here