Semaphorin 3A: A potential target for prevention and treatment of nickel allergy

0
32

Mice

Female C57BL/6J mice (8-week-old) were purchased from Charles River Laboratories, Inc. (Kanagawa, Japan). K5-cre52 mice (STOCK-Tg(K5-Cre) Jt) were obtained from CARD R-BASE, Kumamoto University. K5-Cre-specificity was determined using forward and reverse primers GAACCTGATGGACATGTTCAGG/AGTGCGTTCGAACGCTAGAGCCTGT; and PCR conditions 95 °C for 5 min, [(95 °C for 30 s, 62 °C for 30 s, 72 °C for 30 s) × 35 cycles]then 72 °C for 5 min (band length 320 kb)53. Sema3Afl/f mice (ICR.Cg-Sema3a < tm1.2Tyag > /TyagRbrc, RBRC01106) were provided by RIKEN BRC through the National BioResource Project of the MEXT/AMED, Japan. The genotyping of Sema3Afl/f-specificity was performed determined using Sema3A’s 5′ intron: ACAACGCTTGCCTCGGGAGGTAAA (presence of 1600bp band indicating floxed-type gene) and Sema3A’s 3′ intron: ATGGTTCTGATAGTGAGGCATGG (presence of 1200 bp band indicating wild-type gene); and PCR conditions 94 °C for 5 min, [(94 °C for 30 s, 60 °C for 30 s, 72 °C for 2 min) × 35cycles]then 72 °C for 5 min, according to the previous study54. Sema3Afl/f Conditional mice were crossed with K5-Cre mice to generate Sema3A cKO mice. Wild-type mice of the same genetic background strains were used as control animals. All mice used were aged 6-8 weeks. All mice were maintained under specific pathogen-free conditions and fed with autoclaved diet and water in the animal facilities at Tokushima University, they were treated in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. All experimental procedures were approved by IACUC (No. T2019-51) and Institute for Genome Research (No.30-46) of Tokushima University.

Reagents

Nickel(II) Chloride was obtained from Wako Pure Chemical Corporation. Freund’s incomplete adjuvant (IFA) and complete adjuvant (CFA) were from MP Biomedicals. The primary antibody specific for Sema3A was from Abcam. Antibodies specific for phospho-p38 (Thr180/Tyr182) and p38 were obtained from Cell Signaling Technology. Rabbit antibody to GAPDH was obtained from Osenses. Rabbit antibody to β-actin was obtained from Bioss. Horseradish peroxidase (HRP)-conjugated anti-rabbit secondary antibody were obtained from Cell Signaling. FITC anti-mouse CD11c, Alexa Fluor 488 anti-mouse CD11b, PE anti-mouse F4/80, PE anti-mouse IA/IE, FITC anti-mouse CD3, PE/Cyanine7 anti-mouse CD4 and PE anti-mouse CD8a were purchased from BioLegend. APC-Cy™7 Rat Anti-Mouse CD45 and Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™) were from BD Biosciences. 7-AAD Viability Staining Solution was from Invitrogen. Anti-rabbit Alexa Fluor 488 secondary antibody was from Abcam. ReadidropTM Propidium Iodide was from Bio-Rad Laboratories. The recombinant mouse Sema3A were purchased from R&D Systems.

Induction of Ni allergy

Ni allergy was induced on mouse ears according to our previous studies9,10,11. In brief, 25 μl 1 mM NiCl2 with 25 μl IFA was intraperitoneally injected into mice for initial immunization. After two weeks, 10 μl 0.2 mM NiCl2 with 10 μl CFA was intradermally injected into the ear skin as a second challenge. For negative control, PBS with CFA was injected. 48 h later, DTH reaction was observed and confirmed by measuring the ear thickness of mice.

Histology and immunofluorescence microscopy

Frozen sections (4–8 μm) were stained with H&E. Sections for immunofluorescence staining were fixed with pre-cooled acetone (4 °C) for 10 minutes. After this, the slides were rinsed with PBS and blocked with 5% goat serum for 30 min. A 1:300 dilution of primary antibodies or fluorescently-conjugated antibodies was applied to the sections and incubated in a dark humidified chamber overnight at 4 °C, followed by incubation with Alexa Fluor secondary antibody at room temperature for 1 h for not fluorescently- conjugated antibodies. The nuclei were stained with DAPI solution (0.1 µg/ml; Cell Signaling Technology, Danvers, MA, USA). Immunofluorescence images were captured using Keyence all-in-one fluorescence-microscope BZ-X800 (magnification, ×200; ×400; ×1000; KEYENCE CORPORATION, Tokyo, Japan). BZ-X800 Analyzer software was adapted for the extraction and quantification of the imaging data.

Epidermal sheet preparation

Epidermal sheets were prepared using a modification of previously-reported method55,56. In brief, the ears were peeled into halves and put dermis-side down floating on a dish of cold ammonium thiocyanate. After incubated 13 min at 37 °C, the epidermal sheets were peeled with small tweezers. The epidermis flats were washed with PBS and fixed with cold acetone, then used for the following immunofluorescence staining like frozen sections.

Flow cytometry

The single-cell suspensions of mouse ears were prepared based on the previous method57,58. Briefly, the ears were split and cut, incubated with a solution of RPMI containing 1 mg/ml DNase I (NIPPON GENE, Tokyo, Japan) and 1 mg/ml collagenase (Worthington Biochemical, Lakewood, NJ, USA) 90 min at 37 °C. 1 x 106 cells of homogeneous cell suspension were incubated with Purified Rat Anti-Mouse CD16/CD32 for 5 min and stained with FITC anti-mouse CD11c, PE anti-mouse F4/80, APC-Cy™7 anti-mouse CD45, FITC anti-mouse CD3, PE/Cyanine7 anti-mouse CD4, PE anti-mouse CD8a, 7-AAD according to the recommended concentration. FITC Armenian Hamster IgG and PE Rat IgG2a, κ were used for isotype control. 1 x 106 Pam2.12 cells were stained with ReadidropTM Propidium Iodide (Bio-Rad Laboratories, Inc., CA, USA) according to the manufacturer instructions. Cells were analyzed on BD FACSVerse™ (BDBiosciences, San Jose, CA, USA).

Cell culture and siRNA transfection

Mouse keratinocyte cell line Pam2.12 was kindly provided by Dr. SH Yuspa (National Cancer Institute, Bethesda)59. 1 x 107 cells/10 cm dish were cultured in DMEM (nacalai tesque, Kyoto, Japan) supplemented with 10% FBS and 1% penicillin/streptomycin/amphotericin B in a humidified atmosphere of 5% CO2 at 37 °C. Pam2.12 cells were stimulated with 250 μM NiCl2 for 0, 6, 12, 24, 48, 72 h before analysis (The concentration was decided according to previous study11). The Sema3A esiRNA was obtained from Sigma-Aldrich (Tokyo, Japan). Pam2.12 cells were transfected with 50 nM of Sema3A siRNA using INTERFERin (Polyplus transfection, Illkirch, France) in half-decreased-volume serum-free DMEM, after 4 h, complete DMEM volume was added to restore the usual culture. Medium was changed 24 h after transfection and 250 μM NiCl2 was added to the cells for another 24 and 48 h.

T cells were collected from mouse spleen. The splen was removed and grinded with the flat end of a syringe to pass through a cell strainer into a 50 ml tube. After washed with 5 ml of PBS twice, the cell pellet was re-suspended with red blood lysis buffer for 15 minutes. Cells were washed and spined down, cultured in a 6-well plate with 2 ml of RPMI containing 10% FBS and 1% penicillin/streptomycin/amphotericin B per well for 24 h. 10 µl of PBS, 50 µM of NiCl2, 5 μg/ml of ConA was added to cells with or without recombinant mouse Sema3A (100 ng/ml) for 48 h. After which total RNA of cells were collected for subsequent analysis of quantitative RT-PCR.

Immunocytochemistry

Pam2.12 cells were seeded in dish with glass coverslips at the bottom. 250 μM NiCl2 was added when cells grew to 40% confluency. After NiCl2 Stimulation for 24 or 48 h, coverslips were removed and washed with PBS, followed by fixation with 4% paraformaldehyde at room temperature for 10 min. Then the coverslips were incubated in 0.25% Triton X-100 in PBS at room temperature for another 10 min and blocked in 3% BSA for 30 min. Finally, they were stained with immunofluorescence like frozen sections.

Quantitative RT-PCR

The total RNA of Pam2.12, mouse ears and splenic T cells were extracted. cDNA was made using PrimeScript™ RT reagent Kit (TaKaRa Biotech, Shiga, Japan). TaKaRa Ex Taq® DNA Polymerase (TaKaRa Biotech, Shiga, Japan) was used for preliminary experiment to confirm expressions. qPCR was performed using TB Green® Premix Ex Taq™ II (TaKaRa Biotech, Shiga, Japan) in a total volume of 15 µl with ABI7300 Real-time PCR System (Applied Biosystems, MA, USA) according to manufacturer instructions. The polymerase was initially activated at 95 °C for 30 s, then the PCR was run in 40 cycles of denaturation at 95 °C for 5 s and annealing/extension at 60 °C for 31 s. The sequences for primers were as follows: Sema3a, forward: 5′-GAAGAGCCCTTATGATCCCAAAC-3′; reverse: 5′-AGATAGCGAAGTCCCGTCCC-3′. Tnf-alpha, forward: 5′-ATGGCCTCCCTCTCATCAGT-3′; reverse: 5′-CTTGGTGGTTTGCTACGACG-3′. Il1b, forward: 5′-GCTGAAAGCTCTCCACCTCA-3′; reverse: 5′-AGGCCACAGGTATTTTGTCG-3′. Il23, forward: 5′-CCAGCAGCTCTCTCTCGGAATC-3′; reverse: 5′-TCATATGTCCCGCTGGTGC-3′. Cxcl1, forward: 5′-CCGAAGTCATAGCCACACTCAA-3′; reverse: 5′-GCAGTCTGTCTTCTTTCTCCGTTA-3′. Ccl20, forward: 5′-GTACTGCTGGCTCACCTCTG-3′; reverse: 5′-CTTCATCGGCCATCTGTCTTGTG-3′. Il1rn, forward: 5′-TGTGCCTGTCTTGTGCCAAGTC-3′; reverse: 5′- GCCTTTCTCAGAGCGGATGAAG-3′. Il6, forward: 5′- TACCACTTCCAAGTCGGAGGC-3′; reverse: 5′-CTGCAAGTGCATCATCATCGTTGTTC-3′. Il10, forward: 5′- CGGGAAGACAATAACTGCACCC-3′; reverse: 5′-CGGTTTAGCAGTATGTTGTCCAGC-3′. Il11, forward: 5′- CTGACGGAGATCACAGTCTGGA-3′; reverse: 5′-GGACATCAAGTCTACTCGAAGCC-3′. Il13, forward: 5′- AACGGCAGCATGGTATGGAGTG-3′; reverse: 5′-TGGGTCCTGTAGATGGCATTGC-3′. Tgf-beta, forward: 5′- TGATACCCTGAGTGGCTGTCT-3′; reverse: 5′-CACAAGAGAGAGTGAGCGCTGAA-3′. Il2, forward: 5′-GCTGTTGATGGACCTACAGGA-3′; reverse: 5′-TTCAATTCTGTGGCCTGCTT-3′. Ifn-gamma, forward: 5′-GGCCATCAGCAACAACATAAGCGT-3′; reverse: TGGGTTGTTGACCTCAAACTTGGC-3′. Il4, forward: 5′-TGTACCAGGAGCCATATCCAC-3′; reverse: 5′-GTTCTTCGTTGCTGTGAGGAC-3′. Actb, forward: 5′-TCTGGCTCCTAGCACCATGAAGA-3′; reverse: 5′-GGGACTCATCGTACTCCTGCTTG-3′. Gene expression was normalized to levels of β-actin.

Western blotting analysis

NiCl2-stimulated Pam2.12 cells were washed in cold PBS before lysis in 60 µl of RIPA buffer (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan) containing 1:100 EZBlock™ Protease Inhibitor Cocktail (BioVision, San Francisco, CA, USA). Tissue extracts were prepared by homogenizing mouse ear tissue in lysis buffer. Proteins were separated in a 10% SDS-PAGE acrylamide gel for Pam2.12, transferred onto a polyvinylidene fluoride membrane. Membranes were incubated with primary antibodies against Sema3A, phosohorylated-p38 MAPK at 4°C overnight. Total p38 MAPK and β-actin or GAPDH were incubated at room temperature for 1 h. All the primary antibodies were used at a dilution 1:1000. After washing with TBST (0.05 M Tris-HCl, 0.15 M NaCl, pH7.6), a 1:20000 dilution of HRP-conjugated anti-mouse secondary antibody was applied to the membrane for 1 h at room temperature. Membranes were detected with ECL Prime reagents (GE healthcare, Chicago, IL, USA) using ChemiDoc XRS (Bio-Rad, Hercules, CA, USA).

ELISA

Pam2.12 cells were seeded in 96-well dish and stimulated with 250 μM NiCl2 for 0, 12, 24, 48, 72 h before analysis of Sema3A production in medium using a mouse Sema3A ELISA kit (Signalway Antibody, College Park, MD, USA). Pam2.12 cells seeded in 96-well dish was performed with Sema3A siRNA transfection using INTERFERin as described above to suppress Sema3A expression. Culture supernatant 24 h after NiCl2-stimulation was collected and stored at −20 °C until analysis. The TNF-α production was measured using a mouse TNF-α ELISA (eBioscience, San Diego, CA, USA), according to the manufacturer instructions.

Statistics and reproducibility

All experiments were repeated at least three times with similar results. For the Ni allergy induction on mouse ears, at least 3 mice were used for each group of C57BL/6J, Sema3Afl/f, and Sema3A cKO. Experimental values ​​are given as means ± SD. The statistical difference was determined by One-Way ANOVA with LSD (Least Significant Difference), two independent samples t-test. Statistical significance is presented in the following manner: *p< 0.05, **p< 0.01, ***p< 0.001.

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

LEAVE A REPLY

Please enter your comment!
Please enter your name here